Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pHsp70-Cas9
(Plasmid #45945)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45945 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHSS6
  • Backbone size w/o insert (bp) 2300
  • Modifications to backbone
    Cas9 was cloned into pHSS6hsILMi20 (Pavlopoulos et al., 2004) between the hsp70 promoter and 3'UTR using ClaI (5') and XbaI (3').
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Codon optimized Cas9
  • Alt name
    SpCas9
  • Insert Size (bp)
    4272
  • Mutation
    Silent change from C to A at bp 834 of insert
  • Tag / Fusion Protein
    • 3x FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer ctgcagtaaagtgcaagttaaagtg
  • 3′ sequencing primer cccatatgttataacccattgatgaac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information on FlyCRISPR Plasmids and a list of related plasmids please refer to: http://www.addgene.org/crispr/OConnor-Giles/

Plasmid 51019: pDsRed-attP (www.addgene.org/51019) can be for generating dsDNA donors for homology-directed repair to replace genes or other genomic sequence with an attP docking site.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHsp70-Cas9 was a gift from Melissa Harrison & Kate O'Connor-Giles & Jill Wildonger (Addgene plasmid # 45945 ; http://n2t.net/addgene:45945 ; RRID:Addgene_45945)
  • For your References section:

    Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Gratz SJ, Cummings AM, Nguyen JN, Hamm DC, Donohue LK, Harrison MM, Wildonger J, O'Connor-Giles KM. Genetics. 2013 May 24. 10.1534/genetics.113.152710 PubMed 23709638