-
PurposeThe codon-optimized Cas9 nuclease under the control of the Drosophila hsp70 promoter used in Gratz, et al. (2013). Plasmid is low copy number.
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45945 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHSS6
- Backbone size w/o insert (bp) 2300
-
Modifications to backboneCas9 was cloned into pHSS6hsILMi20 (Pavlopoulos et al., 2004) between the hsp70 promoter and 3'UTR using ClaI (5') and XbaI (3').
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCodon optimized Cas9
-
Alt nameSpCas9
-
Insert Size (bp)4272
-
MutationSilent change from C to A at bp 834 of insert
-
Tag
/ Fusion Protein
- 3x FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer ctgcagtaaagtgcaagttaaagtg
- 3′ sequencing primer cccatatgttataacccattgatgaac (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byFeng Zhang, Broad Institute, MIT
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on FlyCRISPR plasmids and a list of related plasmids please refer to: https://www.addgene.org/browse/article/6834/.
Plasmid 51019: pDsRed-attP (www.addgene.org/51019) can be for generating dsDNA donors for homology-directed repair to replace genes or other genomic sequence with an attP docking site.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHsp70-Cas9 was a gift from Melissa Harrison & Kate O'Connor-Giles & Jill Wildonger (Addgene plasmid # 45945 ; http://n2t.net/addgene:45945 ; RRID:Addgene_45945) -
For your References section:
Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Gratz SJ, Cummings AM, Nguyen JN, Hamm DC, Donohue LK, Harrison MM, Wildonger J, O'Connor-Giles KM. Genetics. 2013 May 24. 10.1534/genetics.113.152710 PubMed 23709638