Skip to main content

CMV-mito-R-GECO1
(Plasmid #46021)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46021 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1 (-)
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 6854
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    R-GECO1
  • Species
    Synthetic
  • Insert Size (bp)
    1254
  • Mutation
    Substitutions relative to the mApple-derived analogue of GCaMP3: T47A/L60P/E61V/S63V/E64S/R81G/K83R/Y134C/M158L/N164aD/V228A/ S290P/I366F/K380N/S404G/N414D/E430V
  • GenBank ID
    JN258411
  • Promoter CMV
  • Tag / Fusion Protein
    • a duplex of the mitochondrial targeting signal of cytochrome c oxidase subunit VIII (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The vector of the CMV-mito-R-GECO1 is based on the mitATeam1.03 pcDNA plasmid reported here:
(http://www.pnas.org/content/106/37/15651.abstract)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-mito-R-GECO1 was a gift from Robert Campbell (Addgene plasmid # 46021 ; http://n2t.net/addgene:46021 ; RRID:Addgene_46021)
  • For your References section:

    Improved Orange and Red Ca Indicators and Photophysical Considerations for Optogenetic Applications. Wu J, Liu L, Matsuda T, Zhao Y, Rebane A, Drobizhev M, Chang YF, Araki S, Arai Y, March K, Hughes TE, Sagou K, Miyata T, Nagai T, Li WH, Campbell RE. ACS Chem Neurosci. 2013 Mar 19. 10.1021/cn400012b PubMed 23452507