-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46761 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepT7-gRNA
- Backbone size w/o insert (bp) 2542
- Total vector size (bp) 2526
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametyr gRNA
-
Alt nametyr
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)20
-
Entrez Genetyr (a.k.a. sandy, zgc:109705)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer M13 R
- 3′ sequencing primer M13 F (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/
gRNA target sequence CCCCAGAAGTCCTCCAGTCC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7tyrgRNA was a gift from Wenbiao Chen (Addgene plasmid # 46761 ; http://n2t.net/addgene:46761 ; RRID:Addgene_46761) -
For your References section:
Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Jao LE, Wente SR, Chen W. Proc Natl Acad Sci U S A. 2013 Aug 5. 10.1073/pnas.1308335110 PubMed 23918387