Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pU6-sgGAL4-1
(Plasmid #46915)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46915 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSICO derivative
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 8200
  • Total vector size (bp) 8308
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    sgGAL4-1
  • Insert Size (bp)
    103
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstX1 (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer cttgtgggagaagctcggcta
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Puromycin resistance and mCherry
  • Insert Size (bp)
    1377
  • Promoter CMV

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA target sequence GTTGGAGCACTGTCCTCCGAACGT

For more information on Qi and Wiessman Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Qi-weissman/ and http://www.addgene.org/crispr/qi/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-sgGAL4-1 was a gift from Stanley Qi & Jonathan Weissman (Addgene plasmid # 46915 ; http://n2t.net/addgene:46915 ; RRID:Addgene_46915)
  • For your References section:

    CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Gilbert LA, Larson MH, Morsut L, Liu Z, Brar GA, Torres SE, Stern-Ginossar N, Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. 10.1016/j.cell.2013.06.044 PubMed 23849981