-
PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting endogenous CD71 gene
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46918 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSICO derivative
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 8200
- Total vector size (bp) 8308
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namesgCD71 -2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)103
-
Entrez GeneTFRC (a.k.a. CD71, IMD46, T9, TFR, TFR1, TR, TRFR, p90)
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BstX1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer cttgtgggagaagctcggcta (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePuromycin resistance and mCherry
-
Insert Size (bp)1377
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer caccccattgacgtcaatggg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA target sequence GGACGCGCTAGTGTGAGTGC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-sgCD71-2 was a gift from Stanley Qi & Jonathan Weissman (Addgene plasmid # 46918 ; http://n2t.net/addgene:46918 ; RRID:Addgene_46918) -
For your References section:
CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Gilbert LA, Larson MH, Morsut L, Liu Z, Brar GA, Torres SE, Stern-Ginossar N, Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. 10.1016/j.cell.2013.06.044 PubMed 23849981