-
PurposePlasmid for cloning and epression of GFP-FLAG tagged human Ku70 (N-terminal tag). Confers resistance to G418.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46957 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1-FLAG
- Backbone size w/o insert (bp) 4766
- Total vector size (bp) 6543
-
Modifications to backboneInserted a FLAG tag and XhoI and NotI unique restriction sites between BglII and HindIII.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKu70
-
Alt nameXRCC6
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1830
-
GenBank IDNM_001469.3
-
Entrez GeneXRCC6 (a.k.a. CTC75, CTCBF, G22P1, KU70, ML8, TLAA)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP-FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer GCAAGTAAAACCTCTACAAATGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1-FLAG-Ku70 was a gift from Steve Jackson (Addgene plasmid # 46957 ; http://n2t.net/addgene:46957 ; RRID:Addgene_46957) -
For your References section:
A new method for high-resolution imaging of Ku foci to decipher mechanisms of DNA double-strand break repair. Britton S, Coates J, Jackson SP. J Cell Biol. 2013 Jul 29. 10.1083/jcb.201303073 PubMed 23897892