Skip to main content
Addgene

pEGFP-C1-FLAG-Ku70
(Plasmid #46957)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46957 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1-FLAG
  • Backbone size w/o insert (bp) 4766
  • Total vector size (bp) 6543
  • Modifications to backbone
    Inserted a FLAG tag and XhoI and NotI unique restriction sites between BglII and HindIII.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ku70
  • Alt name
    XRCC6
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1830
  • GenBank ID
    NM_001469.3
  • Entrez Gene
    XRCC6 (a.k.a. CTC75, CTCBF, G22P1, KU70, ML8, TLAA)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP-FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer GCAAGTAAAACCTCTACAAATGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C1-FLAG-Ku70 was a gift from Steve Jackson (Addgene plasmid # 46957 ; http://n2t.net/addgene:46957 ; RRID:Addgene_46957)
  • For your References section:

    A new method for high-resolution imaging of Ku foci to decipher mechanisms of DNA double-strand break repair. Britton S, Coates J, Jackson SP. J Cell Biol. 2013 Jul 29. 10.1083/jcb.201303073 PubMed 23897892