pDR-AmTrac-100
              
              
                (Plasmid
                
                #47771)
              
            
            
            
          - 
            Purposeexpresses AmTrac-100 in yeast
- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 47771 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepDR GW
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 8200
- 
              Vector typeYeast Expression
- 
                Selectable markersURA3
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)Top10
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameAmTrac-100
- 
                    SpeciesA. thaliana (mustard weed), Synthetic
- 
                  Insert Size (bp)2229
- 
                  MutationA141E, T464D
- Promoter PMA
- 
    
        Tag
        / Fusion Protein
    - mcpGFP
 
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer aacaatcgttaataattaattaattgg
- 3′ sequencing primer gaagtgtcaacaacgtatctacc (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pDR-AmTrac-100 was a gift from Wolf Frommer (Addgene plasmid # 47771 ; http://n2t.net/addgene:47771 ; RRID:Addgene_47771)
- 
                For your References section: Fluorescent sensors reporting the activity of ammonium transceptors in live cells. De Michele R, Ast C, Loque D, Ho CH, Andrade SL, Lanquar V, Grossmann G, Gehne S, Kumke MU, Frommer WB. eLife. 2013 Jul 2;2:e00800. 10.7554/eLife.00800 PubMed 23840931