Skip to main content

pET-PesaRlux
(Plasmid #47802)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47802 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-17b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 2934
  • Total vector size (bp) 9177
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PesaR-luxCDABE-term
  • Insert Size (bp)
    6243
  • Promoter PesaR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer cgaaaagtgccacctgacgtctaag
  • 3′ sequencing primer aatcatcactttcgggaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

PesaR-luxCDABE-transcriptional terminator fragment from pCS-PesaRlux is between XhoI and BglII sites in pET17b.

PesaR (274bp, indicated as lowercase letters in the 2nd partial sequence for PesaR between XhoI and BamHI) is located between XhoI and BamHI sites. luxCDABE is located between two NotI sites. The transcriptional terminator is located downstream of luxCDABE between the second NotI and BglII.

Sequencing primers provided were used to sequence PesaR.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-PesaRlux was a gift from Cynthia Collins (Addgene plasmid # 47802 ; http://n2t.net/addgene:47802 ; RRID:Addgene_47802)
  • For your References section:

    Engineering the esaR Promoter for Tunable Quorum Sensing-Dependent Gene Expression. Shong J, Collins CH. ACS Synth Biol. 2013 Jul 23. 10.1021/sb4000433 PubMed 23879176