-
PurposeGenetically encoded voltage indicator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 47978 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG
-
Backbone manufacturercustom
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVSFP Butterfly 1.2
-
SpeciesSynthetic
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site AflII (unknown if destroyed)
- 5′ sequencing primer atgaggagccgctttgtgaagaaagatggtcattgcaatgttcagtttatcaacgtgatggtgtctaaggg
- 3′ sequencing primer gaccgccgccgggatcactctcggcatggacgagctgtacaagtaag
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-VSFP Butterfly 1.2 was a gift from Thomas Knopfel (Addgene plasmid # 47978 ; http://n2t.net/addgene:47978 ; RRID:Addgene_47978) -
For your References section:
Imaging neural circuit dynamics with a voltage-sensitive fluorescent protein. Akemann W, Mutoh H, Perron A, Park YK, Iwamoto Y, Knopfel T. J Neurophysiol. 2012 Oct;108(8):2323-37. doi: 10.1152/jn.00452.2012. Epub 2012 Jul 18. 10.1152/jn.00452.2012 PubMed 22815406