Twitch-1 pRSETB
(Plasmid
#48207)
-
PurposeFluorescent reporter for calcium signaling
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 48207 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRSETB
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2900
- Total vector size (bp) 4750
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTwitch-1
-
Insert Size (bp)1690
- Promoter T7
-
Tags
/ Fusion Proteins
- 6xHIS (N terminal on backbone)
- ECFP (N terminal on insert)
- cpCit174 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ATGGTGAGCAAGGGCGAGGAG
- 3′ sequencing primer cacaacattgaggattga (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Twitch-1 pRSETB was a gift from Oliver Griesbeck (Addgene plasmid # 48207 ; http://n2t.net/addgene:48207 ; RRID:Addgene_48207) -
For your References section:
Real-time in vivo analysis of T cell activation in the central nervous system using a genetically encoded calcium indicator. Mues M, Bartholomaus I, Thestrup T, Griesbeck O, Wekerle H, Kawakami N, Krishnamoorthy G. Nat Med. 2013 Jun;19(6):778-83. doi: 10.1038/nm.3180. Epub 2013 May 12. 10.1038/nm.3180 PubMed 23685843