Skip to main content

Twitch-1 pRSETB
(Plasmid #48207)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 48207 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRSETB
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 4750
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Twitch-1
  • Insert Size (bp)
    1690
  • Promoter T7
  • Tags / Fusion Proteins
    • 6xHIS (N terminal on backbone)
    • ECFP (N terminal on insert)
    • cpCit174 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ATGGTGAGCAAGGGCGAGGAG
  • 3′ sequencing primer cacaacattgaggattga
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Twitch-1 pRSETB was a gift from Oliver Griesbeck (Addgene plasmid # 48207 ; http://n2t.net/addgene:48207 ; RRID:Addgene_48207)
  • For your References section:

    Real-time in vivo analysis of T cell activation in the central nervous system using a genetically encoded calcium indicator. Mues M, Bartholomaus I, Thestrup T, Griesbeck O, Wekerle H, Kawakami N, Krishnamoorthy G. Nat Med. 2013 Jun;19(6):778-83. doi: 10.1038/nm.3180. Epub 2013 May 12. 10.1038/nm.3180 PubMed 23685843