Skip to main content

pAC94-pmax-dCas9VP160-2A-puro
(Plasmid #48226)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 48226 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmax-DEST (Addgene: 48222)
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCas9(D10A;H840A) fusion with VP160 activation domain followed by 2A-puro
  • Alt name
    dCas9VP160-2A-puro
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    5528
  • Mutation
    D10A;H840A (catalytically inactive)
  • Promoter CAGGS
  • Tags / Fusion Proteins
    • HA Tag (N terminal on insert)
    • VP160 (C terminal on insert)
    • 2A-puro (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer gggcttgtcgagacagagaagat
  • 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information including protocols and
updates, please go to http://www.crispr-on.org

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC94-pmax-dCas9VP160-2A-puro was a gift from Rudolf Jaenisch (Addgene plasmid # 48226 ; http://n2t.net/addgene:48226 ; RRID:Addgene_48226)
  • For your References section:

    Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cheng AW, Wang H, Yang H, Shi L, Katz Y, Theunissen TW, Rangarajan S, Shivalila CS, Dadon DB, Jaenisch R. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. 10.1038/cr.2013.122 PubMed 23979020