Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pC1-HyPer-Red
(Plasmid #48249)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 48249 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pC1
  • Backbone size w/o insert (bp) 3975
  • Total vector size (bp) 5406
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HYPER-RED
  • Species
    Synthetic
  • Insert Size (bp)
    1431
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer cggtgggaggtctatataag
  • 3′ sequencing primer tgggaggttttttaaagcaag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC1-HyPer-Red was a gift from Vsevolod Belousov (Addgene plasmid # 48249 ; http://n2t.net/addgene:48249 ; RRID:Addgene_48249)
  • For your References section:

    Red fluorescent genetically encoded indicator for intracellular hydrogen peroxide. Ermakova YG, Bilan DS, Matlashov ME, Mishina NM, Markvicheva KN, Subach OM, Subach FV, Bogeski I, Hoth M, Enikolopov G, Belousov VV. Nat Commun. 2014 Oct 21;5:5222. doi: 10.1038/ncomms6222. 10.1038/ncomms6222 PubMed 25330925