-
Purpose(Empty Backbone) U6-driven sgRNA expressing cassette on a gateway donor vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49045 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCR8GWTOPO
-
Backbone manufacturerInvitrogen
- Backbone size (bp) 2734
-
Modifications to backbonerrnBT1 was truncated to remove a BbsI site that is used for cloning of sgRNA
-
Vector typeMammalian Expression, CRISPR
- Promoter U6
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- 5′ sequencing primer M13F
- 3′ sequencing primer M13R (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe U6-sgRNA-temrinator expression cassette was PCR amplifed from pX335
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT
This vector can be transfected, or transferred to a gateway destination vector ( http://www.lifetechnologies.com/us/en/home/life-science/cloning/gateway-cloning/gateway-destination-vectors.html ), or the U6-sgRNA-terminator fragment can be PCR-amplified and transfected as linear DNA. Another template for such linear DNA is one of the dual expression vectors:
http://www.addgene.org/48240/
http://www.addgene.org/48239/
http://www.addgene.org/48238/
http://www.addgene.org/48236/
For more information including protocols and
updates, please go to http://www.crispr-on.org
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC155-pCR8-sgExpression was a gift from Rudolf Jaenisch (Addgene plasmid # 49045 ; http://n2t.net/addgene:49045 ; RRID:Addgene_49045) -
For your References section:
Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cheng AW, Wang H, Yang H, Shi L, Katz Y, Theunissen TW, Rangarajan S, Shivalila CS, Dadon DB, Jaenisch R. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. 10.1038/cr.2013.122 PubMed 23979020