Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAC155-pCR8-sgExpression
(Plasmid #49045)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 49045 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCR8GWTOPO
  • Backbone manufacturer
    Invitrogen
  • Backbone size (bp) 2734
  • Modifications to backbone
    rrnBT1 was truncated to remove a BbsI site that is used for cloning of sgRNA
  • Vector type
    Mammalian Expression, CRISPR
  • Promoter U6

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The U6-sgRNA-temrinator expression cassette was PCR amplifed from pX335
  • Terms and Licenses

Depositor Comments

Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT

This vector can be transfected, or transferred to a gateway destination vector ( http://www.lifetechnologies.com/us/en/home/life-science/cloning/gateway-cloning/gateway-destination-vectors.html ), or the U6-sgRNA-terminator fragment can be PCR-amplified and transfected as linear DNA. Another template for such linear DNA is one of the dual expression vectors:

http://www.addgene.org/48240/
http://www.addgene.org/48239/
http://www.addgene.org/48238/
http://www.addgene.org/48236/

For more information including protocols and
updates, please go to http://www.crispr-on.org

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC155-pCR8-sgExpression was a gift from Rudolf Jaenisch (Addgene plasmid # 49045 ; http://n2t.net/addgene:49045 ; RRID:Addgene_49045)
  • For your References section:

    Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cheng AW, Wang H, Yang H, Shi L, Katz Y, Theunissen TW, Rangarajan S, Shivalila CS, Dadon DB, Jaenisch R. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. 10.1038/cr.2013.122 PubMed 23979020