-
Purposeexpression of Rab5 fused to mCherry
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49201 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonemCh-alpha tubulin (Addgene plasmid 49149)
-
Backbone manufacturerVoeltz lab
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRab5
-
Alt nameRAB5B, member RAS oncogene family
-
SpeciesH. sapiens (human)
-
Entrez GeneRAB5B
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer mCherry-F (ccccgtaatgcagaagaaga) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCh-Rab5 was a gift from Gia Voeltz (Addgene plasmid # 49201 ; http://n2t.net/addgene:49201 ; RRID:Addgene_49201) -
For your References section:
ER sliding dynamics and ER-mitochondrial contacts occur on acetylated microtubules. Friedman JR, Webster BM, Mastronarde DN, Verhey KJ, Voeltz GK. J Cell Biol. 2010 Aug 9;190(3):363-75. doi: 10.1083/jcb.200911024. 10.1083/jcb.200911024 PubMed 20696706