Skip to main content

pTriEx4-H6-FGAm (FlincG3)
(Plasmid #49202)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49202 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTriEx4
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5238
  • Total vector size (bp) 6768
  • Modifications to backbone
    PshA I site was used at 5' direction for inserting the insert into vector. This site was lost after ligation.
  • Vector type
    Mammalian Expression, Bacterial Expression, Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FlincG3
  • Alt name
    H6-FGAm
  • Alt name
    MCWEx
  • Species
    B. taurus (bovine); GFP
  • Insert Size (bp)
    1764
  • Mutation
    Met to Lys in cpEGFP region similar to CGaMP3
  • Promoter CMV
  • Tag / Fusion Protein
    • His tag + other tags (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PshA I (destroyed during cloning)
  • 3′ cloning site Not I (not destroyed)
  • 5′ sequencing primer CCGGAGTTAATCCGGGACCT
  • 3′ sequencing primer NONE
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Prof. Wolfgang Dostmann at University of Vermont, USA.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTriEx4-H6-FGAm (FlincG3) was a gift from John Garthwaite (Addgene plasmid # 49202 ; http://n2t.net/addgene:49202 ; RRID:Addgene_49202)
  • For your References section:

    Improved genetically-encoded, FlincG-type fluorescent biosensors for neural cGMP imaging. Bhargava Y, Hampden-Smith K, Chachlaki K, Wood KC, Vernon J, Allerston CK, Batchelor AM, Garthwaite J. Front Mol Neurosci. 2013 Sep 24;6:26. doi: 10.3389/fnmol.2013.00026. 10.3389/fnmol.2013.00026 PubMed 24068983