Skip to main content

SRAcode_in_pUC57_v3(767-1356)
(Plasmid #49826)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49826 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC57
  • Backbone manufacturer
    unknown
  • Backbone size w/o insert (bp) 2710
  • Total vector size (bp) 3071
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    steroid receptor RNA activator RNA coding
  • Alt name
    SRA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    590
  • Mutation
    KpnI site at 5' start of RNA coding seq
  • GenBank ID
    NM_001035235
  • Entrez Gene
    SRA1 (a.k.a. SRA, SRAP, STRAA1, pp7684)
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GGCTTAACTATGCGGCATCAGAGC
  • 3′ sequencing primer CAGCTATGACCATGATTACGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SRAcode_in_pUC57_v3(767-1356) was a gift from Thomas Cech (Addgene plasmid # 49826 ; http://n2t.net/addgene:49826 ; RRID:Addgene_49826)
  • For your References section:

    Structure and function of steroid receptor RNA activator protein, the proposed partner of SRA noncoding RNA. McKay DB, Xi L, Barthel KK, Cech TR. J Mol Biol. 2014 Apr 17;426(8):1766-85. doi: 10.1016/j.jmb.2014.01.006. Epub 2014 Jan 30. 10.1016/j.jmb.2014.01.006 PubMed 24486609