Skip to main content

pME-mCherry-FLAG-CD59-GPI
(Plasmid #50378)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50378 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pME-FLAG-CD59-GPI
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 6200
  • Modifications to backbone
    mCherry was amplified by PCR from pBS35 (Yeast Resource Center) by using upper and lower primers both containing NsiI sites and integrated into the pME-FLAG-CD59-GPI at SbfI site
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Alt name
    mCherry-FLAG-CD59
  • Species
    Synthetic
  • Insert Size (bp)
    700
  • Promoter SR alpha

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SbfI (destroyed during cloning)
  • 3′ cloning site SbfI (destroyed during cloning)
  • 5′ sequencing primer gtgagcaagggcgaggaggat
  • 3′ sequencing primer cttgtacagctcgtccatgcc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Roger Tsien, PhD, Professor of Pharmacology at UC San Diego
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pME-mCherry-FLAG-CD59-GPI was a gift from Reika Watanabe (Addgene plasmid # 50378 ; http://n2t.net/addgene:50378 ; RRID:Addgene_50378)
  • For your References section:

    Exit of GPI-anchored proteins from the ER differs in yeast and mammalian cells. Rivier AS, Castillon GA, Michon L, Fukasawa M, Romanova-Michaelides M, Jaensch N, Hanada K, Watanabe R. Traffic. 2010 Aug;11(8):1017-33. doi: 10.1111/j.1600-0854.2010.01081.x. Epub 2010 May 11. 10.1111/j.1600-0854.2010.01081.x PubMed 20477992