Skip to main content

RANLS-DEVD-BNES
(Plasmid #50840)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50840 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 7024
  • Modifications to backbone
    Multi cloning sites has been replaced by a customized sequence, which is compatible to the reading frame of vector pBAD hisB.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ddRFP A and ddRFP B
  • Alt name
    dimerization dependent red fluorescent protein (ddRFP)
  • Species
    Synthetic; synthetic construct
  • Insert Size (bp)
    1524
  • GenBank ID
    KF976776
  • Promoter CMV
  • Tags / Fusion Proteins
    • triplicated NLS sequence DPKKKRKV placed after ddRFP A
    • NES sequence LALKLAGLDIGS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There is a small discrepancy between the reference sequence and Addgene's quality control sequence, this causes an A to G mutation in the linker region between NLS and ddRFP B. This change should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RANLS-DEVD-BNES was a gift from Robert Campbell (Addgene plasmid # 50840 ; http://n2t.net/addgene:50840 ; RRID:Addgene_50840)
  • For your References section:

    Ratiometric biosensors based on dimerization-dependent fluorescent protein exchange. Ding Y, Li J, Enterina JR, Shen Y, Zhang I, Tewson PH, Mo GC, Zhang J, Quinn AM, Hughes TE, Maysinger D, Alford SC, Zhang Y, Campbell RE. Nat Methods. 2015 Jan 26. doi: 10.1038/nmeth.3261. 10.1038/nmeth.3261 PubMed 25622108