Skip to main content

pCAG-hCas9
(Plasmid #51142)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51142 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    clontech
  • Backbone size w/o insert (bp) 5800
  • Total vector size (bp) 9960
  • Modifications to backbone
    CMV promoter is replaced with CAG promoter.
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hCas9
  • Insert Size (bp)
    4160
  • Promoter CAG
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn I (not destroyed)
  • 3′ cloning site Not I (not destroyed)
  • 5′ sequencing primer CGGCTTCTGGCGTGTGACC
  • 3′ sequencing primer TTGCATTCATTTTATGTTTCAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    hCas9 (Addgene: 41815) CAG promoter from Dr. Jun-ichi Miyazaki

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-hCas9 was a gift from Izuho Hatada (Addgene plasmid # 51142 ; http://n2t.net/addgene:51142 ; RRID:Addgene_51142)
  • For your References section:

    Generation of an ICF syndrome model by efficient genome editing of human induced pluripotent stem cells using the CRISPR system. Horii T, Tamura D, Morita S, Kimura M, Hatada I. Int J Mol Sci. 2013 Sep 30;14(10):19774-81. doi: 10.3390/ijms141019774. 10.3390/ijms141019774 PubMed 24084724