pREPK219H
(Plasmid
#51492)
-
PurposepREP with a mutation in the ATPase domain (K219H). This is predicted to result in loss of geminivirus replication.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51492 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMDC32
- Backbone size w/o insert (bp) 10000
- Total vector size (bp) 11216
-
Vector typeplant expression T-DNA
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRep/RepA
-
Speciesbean yellow dwarf virus
-
Insert Size (bp)1000
-
Mutationchanged lysine 219 to histidine
-
GenBank IDDQ458791
- Promoter 2x35S
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer atgccttctgctagtaagaactt
- 3′ sequencing primer aggcacgttcagtgactcga (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byI did not originally clone the gene. Rep/RepA coding sequence was synthesized on g-Blocks from IDT.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pREPK219H was a gift from Daniel Voytas (Addgene plasmid # 51492 ; http://n2t.net/addgene:51492 ; RRID:Addgene_51492) -
For your References section:
DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519