Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pREPK219H
(Plasmid #51492)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51492 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMDC32
  • Backbone size w/o insert (bp) 10000
  • Total vector size (bp) 11216
  • Vector type
    plant expression T-DNA
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rep/RepA
  • Species
    bean yellow dwarf virus
  • Insert Size (bp)
    1000
  • Mutation
    changed lysine 219 to histidine
  • GenBank ID
    DQ458791
  • Promoter 2x35S

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer atgccttctgctagtaagaactt
  • 3′ sequencing primer aggcacgttcagtgactcga
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    I did not originally clone the gene. Rep/RepA coding sequence was synthesized on g-Blocks from IDT.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pREPK219H was a gift from Daniel Voytas (Addgene plasmid # 51492 ; http://n2t.net/addgene:51492 ; RRID:Addgene_51492)
  • For your References section:

    DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan 17. 10.1105/tpc.113.119792 PubMed 24443519