Skip to main content
Addgene

p35SZ
(Plasmid #51513)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51513 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMDC32
  • Backbone size w/o insert (bp) 11752
  • Total vector size (bp) 14248
  • Vector type
    plant expression T-DNA
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Zif268:FokI
  • Species
    fusion between human and bacterial genes
  • Insert Size (bp)
    897
  • Promoter 2x35S
  • Tag / Fusion Protein
    • NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gateway Cloning
  • 5′ sequencing primer atggcttcctcccctccaaag
  • 3′ sequencing primer ctattaaaagtttatctcacc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    3kb filler sequence
  • Alt name
    ALS repair template
  • Species
    N. tabacum
  • Insert Size (bp)
    3000

Cloning Information for Gene/Insert 2

  • Cloning method Gateway Cloning
  • 5′ sequencing primer tgcgagatcgggccggcctggc
  • 3′ sequencing primer gatattttgaattaaagataac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Zif268:FokI and the 3 kb filler sequence were PCR amplified from pDW1345 and pZHY455. Zif268 was cloned into pNJB91 and the 3 kb filler sequence was cloned into pNJB80. pNJB80 and pNJB91 were used in a multi-site Gateway reaction with pMDC32.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that there may be some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequence. These discrepancies are not in functionally relevant regions of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p35SZ was a gift from Daniel Voytas (Addgene plasmid # 51513 ; http://n2t.net/addgene:51513 ; RRID:Addgene_51513)
  • For your References section:

    DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519