p35SZ
(Plasmid
#51513)
-
PurposepMDC32 with Zif268:FokI followed by approximately 3kb of filler sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51513 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMDC32
- Backbone size w/o insert (bp) 11752
- Total vector size (bp) 14248
-
Vector typeplant expression T-DNA
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameZif268:FokI
-
Speciesfusion between human and bacterial genes
-
Insert Size (bp)897
- Promoter 2x35S
-
Tag
/ Fusion Protein
- NLS (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer atggcttcctcccctccaaag
- 3′ sequencing primer ctattaaaagtttatctcacc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert name3kb filler sequence
-
Alt nameALS repair template
-
SpeciesN. tabacum
-
Insert Size (bp)3000
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer tgcgagatcgggccggcctggc
- 3′ sequencing primer gatattttgaattaaagataac
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byZif268:FokI and the 3 kb filler sequence were PCR amplified from pDW1345 and pZHY455. Zif268 was cloned into pNJB91 and the 3 kb filler sequence was cloned into pNJB80. pNJB80 and pNJB91 were used in a multi-site Gateway reaction with pMDC32.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that there may be some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequence. These discrepancies are not in functionally relevant regions of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p35SZ was a gift from Daniel Voytas (Addgene plasmid # 51513 ; http://n2t.net/addgene:51513 ; RRID:Addgene_51513) -
For your References section:
DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519