Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

SpyLigase
(Plasmid #51722)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51722 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDEST14
  • Backbone manufacturer
    Life Technologies
  • Backbone size w/o insert (bp) 6400
  • Total vector size (bp) 6727
  • Modifications to backbone
    N/A
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpyLigase
  • Species
    Synthetic
  • Insert Size (bp)
    327
  • GenBank ID
    KJ401122
  • Promoter T7
  • Tag / Fusion Protein
    • His6 Tag (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

SnoopLigase is the more recent peptide-peptide ligation technology from the Howarth lab and is now preferred over SpyLigase in terms of more general reaction conditions and higher coupling yield on a range of proteins.

pET28a-AviTag-SnoopLigase https://www.addgene.org/105626/
pET28a-HaloTag7-SnoopLigase https://www.addgene.org/105627/

SpyLigase peptide-peptide ligation polymerizes affibodies to enhance magnetic cancer cell capture. Jacob O. Fierer, Gianluca Veggiani and Mark Howarth

Transform plasmid into BL21 DE3 RIPL for expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SpyLigase was a gift from Mark Howarth (Addgene plasmid # 51722 ; http://n2t.net/addgene:51722 ; RRID:Addgene_51722)
  • For your References section:

    SpyLigase peptide-peptide ligation polymerizes affibodies to enhance magnetic cancer cell capture. Fierer JO, Veggiani G, Howarth M. Proc Natl Acad Sci U S A. 2014 Mar 17. 10.1073/pnas.1315776111 PubMed 24639550