-
PurposePlasmid for recombinant expression in bacteria of SUMO domain fused to KTag, permitting covalent linkage to SpyTag
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51723 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET28a
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 5735
-
Modifications to backboneN/A
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSUMO-KTag
-
SpeciesSynthetic
-
Insert Size (bp)366
-
Mutationnone
-
GenBank IDKJ401122
- Promoter T7
-
Tag
/ Fusion Protein
- His6 Tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SpyLigase peptide-peptide ligation polymerizes affibodies to enhance magnetic cancer cell capture. Jacob O. Fierer, Gianluca Veggiani and Mark Howarth
Transform plasmid into BL21(DE3)pLysS for expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SUMO-KTag was a gift from Mark Howarth (Addgene plasmid # 51723 ; http://n2t.net/addgene:51723 ; RRID:Addgene_51723) -
For your References section:
SpyLigase peptide-peptide ligation polymerizes affibodies to enhance magnetic cancer cell capture. Fierer JO, Veggiani G, Howarth M. Proc Natl Acad Sci U S A. 2014 Mar 17. 10.1073/pnas.1315776111 PubMed 24639550