-
PurposeThis plasmid can be used to mutate genes in Toxoplasma gondii using the CRISPR/Cas9 system after having an appropriate protospacer cloned into it.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52694 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330
- Backbone size w/o insert (bp) 2736
- Total vector size (bp) 8371
-
Vector typeCRISPR ; Toxoplasma gondii
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)dam-/dcm- (NEB catalog # C2925I)
-
Growth instructionsThis plasmid grows fine in DH5a, but BsaI digestion is methylation-sensitive, so growth in a Dcm- strain is necessary prior to inserting a protospacer.
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCas9
-
SpeciesSynthetic; Originally from Streptococcus progenies, codon-optimized for Plasmodium falciparum
-
Insert Size (bp)4270
- Promoter TgTUB1
-
Tags
/ Fusion Proteins
- 3X FLAG (N terminal on insert)
- Nuclear localization signal (N terminal on insert)
- Nuclear localization signal (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer Unknown (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameToxoplasma U6 upstream region - protospacer cloning sequence - chiRNA
-
SpeciesSynthetic; Toxoplasma gondii, streptococcus pyogenes
-
Insert Size (bp)605
- Promoter Toxoplasma U6
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site PciI (destroyed during cloning)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer cacctctgacttgagcgtcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byTim Wang
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cong L, Ran FA, Cox D, Lin S, Barretto R, et al. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339: 819–823. doi:10.1126/science.1231143.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-Universal was a gift from Sebastian Lourido (Addgene plasmid # 52694 ; http://n2t.net/addgene:52694 ; RRID:Addgene_52694)