Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Chicken ArcLight S174
(Plasmid #53567)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53567 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCS2+
  • Backbone size w/o insert (bp) 5701
  • Total vector size (bp) 6955
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Chicken ArcLight-S174
  • Alt name
    Chicken-S174
  • Alt name
    Gg-VSD ArcLight S174
  • Species
    G. gallus (chicken), Synthetic; Aequorea victoria
  • Insert Size (bp)
    1251
  • Mutation
    Gg-VSP contains an R153Q mutation and an amino acid E (GAG) was introduced immediately after the start M (ATG); Gg-VSP is truncated at S175 (S174 in the native Gg-VSP sequence) and super ecliptic pHluorin containing a A227D (FP numbering) mutation is fused to the C-terminal (after S175).
  • GenBank ID
    XP_417079.2 AY533296
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AGAGGGTGAAGGTGATGCAACATAC
  • 3′ sequencing primer ACCTTCGGGCATGGCACTCTTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The chicken voltage sensitive phosphatase (VSP) sequence used in this construct contains an E14K mutation, when compared to the reference sequence XP_417079.2 (the full plasmid sequence provided includes K14). This mutation could be polymorphism at the site or a PCR error. The depositing laboratory states that the plasmid functions as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Chicken ArcLight S174 was a gift from Vincent Pieribone (Addgene plasmid # 53567 ; http://n2t.net/addgene:53567 ; RRID:Addgene_53567)
  • For your References section:

    Fluorescent protein voltage probes derived from ArcLight that respond to membrane voltage changes with fast kinetics. Han Z, Jin L, Platisa J, Cohen LB, Baker BJ, Pieribone VA. PLoS One. 2013 Nov 27;8(11):e81295. doi: 10.1371/journal.pone.0081295. eCollection 2013. 10.1371/journal.pone.0081295 PubMed 24312287