-
PurposeExpresses LexA-ER-B112 in yeast cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58437 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS-derived
-
Backbone manufacturerRobert Gnuegge
- Backbone size w/o insert (bp) 4396
- Total vector size (bp) 7346
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLexA-ER-B112
-
SpeciesSynthetic
-
Insert Size (bp)2950
- Promoter Act1 promoter (-520;1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer AATTAACCCTCACTAAAGGG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For integration in yeast, linearize plasmid with PacI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FRP880_PACT1(-1-520)-LexA-ER-haB112-TCYC1 was a gift from Joerg Stelling (Addgene plasmid # 58437 ; http://n2t.net/addgene:58437 ; RRID:Addgene_58437) -
For your References section:
Inducible, tightly regulated and growth condition-independent transcription factor in Saccharomyces cerevisiae. Ottoz DS, Rudolf F, Stelling J. Nucleic Acids Res. 2014 Jul 17. pii: gku616. 10.1093/nar/gku616 PubMed 25034689