Skip to main content

VV063: 1xCox8 - superecliptic pHluorin in fck
(Plasmid #58500)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58500 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FCK(1.3)GW, from Addgene 22217
  • Backbone size w/o insert (bp) 9240
  • Total vector size (bp) 10059
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Use recombinase-free E. coli.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    1xCox8 - Superecliptic pHluorin
  • Species
    Synthetic
  • Insert Size (bp)
    820
  • GenBank ID
    AY533296
  • Promoter a-CamKII

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCTCGTCAATCAAGCTGGTTC
  • 3′ sequencing primer CCACATAGCGTAAAAGGAGCAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The backbone of this plasmid was derived from Addgene plasmid 22217 (from the Boyden Lab at MIT), cut with BamHI and EcoRI. The Cox8 mitochondrial targeting sequence was amplified from Addgene plasmid 23348, mito-PAGFP). The gene, superecliptic pHluorin, was originally obtained from Gero Miesenbock, at Memorial Sloan-Kettering Cancer Center, New York in the pGEX2T vector.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We obtained the gene for superecliptic pHluorin from the lab of Gero Miesenbock. Superecliptic pHluorin was first published (I believe) in: Ng, Roorda, et al. “Transmission of olfactory information between three population of neurons in the antennal lobe of the fly.” Neuron, 2002. 36(3): 463-74.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VV063: 1xCox8 - superecliptic pHluorin in fck was a gift from Adam Cohen (Addgene plasmid # 58500 ; http://n2t.net/addgene:58500 ; RRID:Addgene_58500)
  • For your References section:

    Imaging GFP-Based Reporters in Neurons with Multiwavelength Optogenetic Control. Venkatachalam V, Cohen AE. Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020. 10.1016/j.bpj.2014.08.020 PubMed 25296307