Skip to main content
Addgene

pSLTS
(Plasmid #59386)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59386 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKDTS
  • Backbone manufacturer
    Herring and Blattner
  • Backbone size (bp) 7742
  • Modifications to backbone
    We constructed pSLTS by correcting three mutations found in pKDTS. One of these mutations resulted in replacement of 5 amino acid residues at the N-terminus of I-SceI with a single amino acid (MHMKNIK to MHQ), and the other two resulted in missense changes of ASN11 to Ser and Lys33 to Arg in TetR (AAC to AGC and AAG to AGG, respectively). Please see GenBank: KP897155.1 for more details.
  • Vector type
    Bacterial Expression ; Genome Engineering

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Mach1
  • Growth instructions
    pSLTS has a temperature sensitive origin of replication and will be lost when cells are grown at temperatures higher than 30 ℃.
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAGGCGCAATCACTTTCGTCTACTC
  • 3′ sequencing primer TTGAGTGACATGCAAAGTAAGTATGATCTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We developed GetX (https://sourceforge.net/projects/getx/) a stand-alone python script that allows the user to design mutation cassettes for scarless genome editing in bacteria using our previously described two-step recombination method. Please see the document linked under the Resource Information heading above for additional information on installing and using the script.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLTS was a gift from Shelley Copley (Addgene plasmid # 59386 ; http://n2t.net/addgene:59386 ; RRID:Addgene_59386)
  • For your References section:

    A versatile and highly efficient method for scarless genome editing in Escherichia coli and Salmonella enterica. Kim J, Webb AM, Kershner JP, Blaskowski S, Copley SD. BMC Biotechnol. 2014 Sep 25;14(1):84. 10.1186/1472-6750-14-84 PubMed 25255806
Commonly requested with: