Skip to main content

pT2SCb
(Plasmid #59385)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59385 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pHA1887, an 1887 bp fragment extending from bp 690 to bp 2576 of pUC19 (Acc. No. M77789)
  • Backbone manufacturer
    Copley Lab
  • Backbone size w/o insert (bp) 1887
  • Total vector size (bp) 2946
  • Vector type
    template

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Mach1
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TT-ISceI-cat2
  • Species
    Synthetic
  • Insert Size (bp)
    1059
  • Mutation
    The 3’-end of the chloramphenicol resistance gene was modified to 5’-AGGAGGTGCATAA to create a sequence resembling the consensus bacterial ribosomal binding site (5’-AGGAGGTAAATAA).
  • GenBank ID
    KP897157.1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tatcagggttattgtctcatg
  • 3′ sequencing primer acttgagcgtcgatttttgtg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

iGEM parts BBa_B1002 and BBa_B1006 were used to build the double terminator element. The chloramphenicol resistance gene was taken from pACYC187. The 3'-end was modified from 5'-GGGCGGGGCGTAA to 5'-AGGAGGTGCATAA in order to provide a site resembling the consensus bacterial ribosomal binding site (5'-AGGAGGTAAATAA). We developed GetX (https://sourceforge.net/projects/getx/) a stand-alone python script that allows the user to design mutation cassettes for scarless genome editing in bacteria using our previously described two-step recombination method. Please see the document linked under the Resource Information heading above for additional information on installing and using the script.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT2SCb was a gift from Shelley Copley (Addgene plasmid # 59385 ; http://n2t.net/addgene:59385 ; RRID:Addgene_59385)
  • For your References section:

    A versatile and highly efficient method for scarless genome editing in Escherichia coli and Salmonella enterica. Kim J, Webb AM, Kershner JP, Blaskowski S, Copley SD. BMC Biotechnol. 2014 Sep 25;14(1):84. 10.1186/1472-6750-14-84 PubMed 25255806
Commonly requested with: