Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSLTS
(Plasmid #59386)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59386 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pKDTS
  • Backbone manufacturer
    Herring and Blattner
  • Backbone size (bp) 7742
  • Modifications to backbone
    We constructed pSLTS by correcting three mutations found in pKDTS. One of these mutations resulted in replacement of 5 amino acid residues at the N-terminus of I-SceI with a single amino acid (MHMKNIK to MHQ), and the other two resulted in missense changes of ASN11 to Ser and Lys33 to Arg in TetR (AAC to AGC and AAG to AGG, respectively). Please see GenBank: KP897155.1 for more details.
  • Vector type
    Bacterial Expression ; Genome Engineering

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Mach1
  • Growth instructions
    pSLTS has a temperature sensitive origin of replication and will be lost when cells are grown at temperatures higher than 30 ℃.
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAGGCGCAATCACTTTCGTCTACTC
  • 3′ sequencing primer TTGAGTGACATGCAAAGTAAGTATGATCTC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pSLTS was constructed from pKDTS, which was originally constructed by C. D. Herring and F. R. Blattner (J. Bacteriology 186: 2673(2004)).
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

We developed GetX (https://sourceforge.net/projects/getx/), a stand-alone python script that allows the user to design mutation cassettes for scarless genome editing in bacteria using our previously described two-step recombination method. Please see the document linked under the Resource Information heading above for additional information on installing and using the script.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLTS was a gift from Shelley Copley (Addgene plasmid # 59386 ; http://n2t.net/addgene:59386 ; RRID:Addgene_59386)
  • For your References section:

    A versatile and highly efficient method for scarless genome editing in Escherichia coli and Salmonella enterica. Kim J, Webb AM, Kershner JP, Blaskowski S, Copley SD. BMC Biotechnol. 2014 Sep 25;14(1):84. 10.1186/1472-6750-14-84 PubMed 25255806