Human BLIMP1 sgRNA
(Plasmid
#59724)
-
PurposePlasmid encoding sgRNA to generate BLIMP1 knockout mutant human cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59724 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepx330
-
Backbone manufacturerFeng Zhang
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehBLIMP1 sgRNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bbs1 (destroyed during cloning)
- 3′ cloning site Bbs1 (destroyed during cloning)
- 5′ sequencing primer TGGCCTTTTGCTCACATGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Human BLIMP1 sgRNA was a gift from Jacob Hanna (Addgene plasmid # 59724 ; http://n2t.net/addgene:59724 ; RRID:Addgene_59724) -
For your References section:
SOX17 is a critical specifier of human primordial germ cell fate. Irie N, Weinberger L, Tang WW, Kobayashi T, Viukov S, Manor YS, Dietmann S, Hanna JH, Surani MA. Cell. 2015 Jan 15;160(1-2):253-68. doi: 10.1016/j.cell.2014.12.013. Epub 2014 Dec 24. 10.1016/j.cell.2014.12.013 PubMed 25543152