IMS-HyPer2
(Plasmid
#60248)
-
PurposeGenetically-encoded fluorescent hydrogen peroxide indicator HyPer2 targeted to mitochondrial intermembrane spase.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60248 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepC1
- Backbone size w/o insert (bp) 4000
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIMS-HyPer2
-
SpeciesSynthetic
-
Insert Size (bp)1668
- Promoter CMV
-
Tag
/ Fusion Protein
- Mitochondrial intermembrane space targeting signal (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ggtgggaggtctatataag
- 3′ sequencing primer cctctacaaatgtggtatgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
IMS-HyPer2 was a gift from Vsevolod Belousov (Addgene plasmid # 60248 ; http://n2t.net/addgene:60248 ; RRID:Addgene_60248) -
For your References section:
Red fluorescent genetically encoded indicator for intracellular hydrogen peroxide. Ermakova YG, Bilan DS, Matlashov ME, Mishina NM, Markvicheva KN, Subach OM, Subach FV, Bogeski I, Hoth M, Enikolopov G, Belousov VV. Nat Commun. 2014 Oct 21;5:5222. doi: 10.1038/ncomms6222. 10.1038/ncomms6222 PubMed 25330925