Skip to main content

pPHT-PIP2
(Plasmid #60937)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60937 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUB2.1
  • Total vector size (bp) 8093
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PIP2 dimerization dependent sensor RA+B monomers
  • Species
    Synthetic
  • Insert Size (bp)
    2604
  • Promoter CMV
  • Tag / Fusion Protein
    • dimerization dependent fluorescent protein monomers RA+B

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer atggtgagcaagagcgaggag
  • 3′ sequencing primer ctggatgttgagctccttcaggaag
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The dimerization-dependent fluorescent protein component of the plasmid was received from Robert Campbell and was originally described in the manuscript below. Alford, S.C., Abdelfattah, A.S., Ding, Y., and Campbell, R.E. (2012). A fluorogenic red fluorescent protein heterodimer. Chem. Biol. 19, 353-360.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Contains a dimerization dependent fluorescent protein, originally described by Alford, S.C., Ding, Y., Simmen, T., and Campbell, R.E. (2012). Dimerization-Dependent Green and Yellow Fluorescent Proteins. ACS Synth. Biol. 1, 569–575.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPHT-PIP2 was a gift from Anne Marie Quinn (Addgene plasmid # 60937 ; http://n2t.net/addgene:60937 ; RRID:Addgene_60937)
  • For your References section:

    Ratiometric biosensors based on dimerization-dependent fluorescent protein exchange. Ding Y, Li J, Enterina JR, Shen Y, Zhang I, Tewson PH, Mo GC, Zhang J, Quinn AM, Hughes TE, Maysinger D, Alford SC, Zhang Y, Campbell RE. Nat Methods. 2015 Jan 26. doi: 10.1038/nmeth.3261. 10.1038/nmeth.3261 PubMed 25622108