pPHT-PIP2
(Plasmid #60937)

• Purpose: Fluorescent FPX sensor for PIP2
• Depositing Lab: Anne Marie Quinn
• Publication: Ding et al Nat Methods. 2015 Jan 26. doi: 10.1038/nmeth.3261.

Backbone

• Vector backbone: pUB2.1
• Total vector size (bp): 8093
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PIP2 dimerization dependent sensor RA+B monomers
• Species: Synthetic
• Insert Size (bp): 2604
• Promoter: CMV
• Tag / Fusion Protein:
  • dimerization dependent fluorescent protein monomers RA+B

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: atggtgagcaagagcgaggag
• 3′ sequencing primer: ctggatgttgagctccttcaggaag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The dimerization-dependent fluorescent protein component of the plasmid was received from Robert Campbell and was originally described in the manuscript below. Alford, S.C., Abdelfattah, A.S., Ding, Y., and Campbell, R.E. (2012). A fluorogenic red fluorescent protein heterodimer. Chem. Biol. 19, 353-360.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Contains a dimerization dependent fluorescent protein, originally described by Alford, S.C., Ding, Y., Simmen, T., and Campbell, R.E. (2012). Dimerization-Dependent Green and Yellow Fluorescent Proteins. ACS Synth. Biol. 1, 569–575.

Addgene NGS results identified a frameshift mutation in the HygR gene originally indicated in this plasmid. The depositing lab has confirmed that their experiments were done with transient transfection and did not make use of Hygromycin selection. For users who need a mammalian selection marker, they recommend moving the biosensor coding region from this plasmid into a different plasmid backbone.