-
Purpose(Empty Backbone) Mammalian expression vector under the neuron-specific promoter NeuroD. Co-expression of GFP with IRES sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61403 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNeuroD-Ires-GFP
- Backbone size (bp) 6911
-
Vector typeMammalian Expression
- Promoter NeuroD
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TCAGCATCAGCAACTCGGCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNeuroD-ires-GFP was a gift from Franck Polleux (Addgene plasmid # 61403 ; http://n2t.net/addgene:61403 ; RRID:Addgene_61403) -
For your References section:
The F-BAR domain of srGAP2 induces membrane protrusions required for neuronal migration and morphogenesis. Guerrier S, Coutinho-Budd J, Sassa T, Gresset A, Jordan NV, Chen K, Jin WL, Frost A, Polleux F. Cell. 2009 Sep 4;138(5):990-1004. doi: 10.1016/j.cell.2009.06.047. 10.1016/j.cell.2009.06.047 PubMed 19737524