- 
            PurposeExpresses NOTCH-ICD in mammalian cells
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61540 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backboneTetO-FUW
 - Backbone size w/o insert (bp) 8376
 - Total vector size (bp) 10836
 - 
              Vector typeMammalian Expression, Lentiviral
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)Stbl3
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameNOTCH-ICD
 - 
                    SpeciesH. sapiens (human)
 - 
                  Insert Size (bp)2460
 - 
                  MutationNOTCH intracellular domain (aa1761-2555); A1943S mutation compared to reference sequence NM_017617.3
 - 
                        Entrez GeneNOTCH1 (a.k.a. AOS5, AOVD1, TAN1, hN1)
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site EcoRI (destroyed during cloning)
 - 3′ cloning site EcoRI (destroyed during cloning)
 - 5′ sequencing primer AAGACCACCGCACAGCAAGC
 - 3′ sequencing primer TTCCGCCGTGGCAATAGGGA (Common Sequencing Primers)
 
Resource Information
- 
            Articles Citing this Plasmid
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
TetO-FUW-NICD was a gift from Rudolf Jaenisch (Addgene plasmid # 61540 ; http://n2t.net/addgene:61540 ; RRID:Addgene_61540) - 
                
For your References section:
Direct Lineage Conversion of Adult Mouse Liver Cells and B Lymphocytes to Neural Stem Cells. Cassady JP, D'Alessio AC, Sarkar S, Dani VS, Fan ZP, Ganz K, Roessler R, Sur M, Young RA, Jaenisch R. Stem Cell Reports. 2014 Nov 6. pii: S2213-6711(14)00307-5. doi: 10.1016/j.stemcr.2014.10.001. 10.1016/j.stemcr.2014.10.001 PubMed 25454632