-
PurposeMammalian expression of IFT88 fused with N terminal TagRFP.T tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61684 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEF5-FRT-DEST
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Mach1
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFT88
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2474
-
GenBank IDBC012250.1
-
Entrez GeneIft88 (a.k.a. Tg737, Tg737Rpw, TgN737Rpw, Ttc10, flexo, fxo, orpk, polaris)
- Promoter EF1a
-
Tag
/ Fusion Protein
- TagRFP.T (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GTTCGAAGGTAAGCCTATCCC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF5-FRT-TagRFP-T-IFT88 was a gift from Maxence Nachury (Addgene plasmid # 61684 ; http://n2t.net/addgene:61684 ; RRID:Addgene_61684) -
For your References section:
Single molecule imaging reveals a major role for diffusion in the exploration of ciliary space by signaling receptors. Ye F, Breslow DK, Koslover EF, Spakowitz AJ, Nelson WJ, Nachury MV. Elife. 2013 Aug 6;2:e00654. doi: 10.7554/eLife.00654. Print 2013. 10.7554/eLife.00654 PubMed 23930224