Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TetO-FUW-VdC9BV
(Plasmid #62195)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 62195 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    TetO-FUW
  • Total vector size (bp) 13824
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VP64dCas9BFPVP64
  • Alt name
    VdC9BV
  • Species
    Synthetic
  • Mutation
    D10A H840A (catalytically inactive) Cas9 (dCas9)
  • Tag / Fusion Protein
    • Two VP64s tagged to dCas9 fused to BFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The vector backbone was from Addgene plasmid 27152 (PI Marius Wernig)
The dCas9:BFP fusion part of the insert was cloned from Addgene plasmid 44247 (PI Stanley Qi)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TetO-FUW-VdC9BV was a gift from Kam Leong (Addgene plasmid # 62195 ; http://n2t.net/addgene:62195 ; RRID:Addgene_62195)
  • For your References section:

    A CRISPR/Cas9-Based System for Reprogramming Cell Lineage Specification. Chakraborty S, Ji H, Kabadi AM, Gersbach CA, Christoforou N, Leong KW. Stem Cell Reports. 2014 Dec 9;3(6):940-7. doi: 10.1016/j.stemcr.2014.09.013. Epub 2014 Oct 23. 10.1016/j.stemcr.2014.09.013 PubMed 25448066