pTrex-b-NLS-hSpCas9
(Plasmid
#62543)
-
PurposeExpression of Cas9 in T. cruzi
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62543 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTrex-b
-
Backbone manufacturerdoi:10.1016/S0378-1119(99)00386-8
- Backbone size w/o insert (bp) 5791
- Total vector size (bp) 10063
-
Modifications to backboneNone
-
Vector typeCRISPR ; Trypanosoma cruzi expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-hSpCas9
-
Insert Size (bp)4272
- Promoter Ribo-HX1
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- NLS (N terminal on insert)
- NLS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TTTTCACGCACGAAAGCGAA
- 3′ sequencing primer CTCCTTCGGCAGGTTGTTCT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byNLS-hSpCas9 insert was subcloned from pX330 from Addgene deposited by Dr Feng Zhang's lab
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTrex-b-NLS-hSpCas9 was a gift from Rick Tarleton (Addgene plasmid # 62543 ; http://n2t.net/addgene:62543 ; RRID:Addgene_62543) -
For your References section:
CRISPR-Cas9-Mediated Single-Gene and Gene Family Disruption in Trypanosoma cruzi. Peng D, Kurup SP, Yao PY, Minning TA, Tarleton RL. MBio. 2014 Dec 30;6(1). pii: e02097-14. doi: 10.1128/mBio.02097-14. 10.1128/mBio.02097-14 PubMed 25550322