Skip to main content

PX852
(Plasmid #62884)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62884 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PX330
  • Backbone manufacturer
    Zhang lab
  • Backbone size w/o insert (bp) 4222
  • Total vector size (bp) 7201
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SpCas9 (aa536-1368)
  • Insert Size (bp)
    2979
  • Promoter CBh
  • Tags / Fusion Proteins
    • NLS SV40 (N terminal on insert)
    • FKBP12 (N terminal on insert)
    • NLS nucleoplasmin (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer ctggagcacctgcctgaaatcact�
  • 3′ sequencing primer GGCTGATCAGCGAGCTCTAG�
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    SpCas9 piece was PCR amplified of PX330
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX852 was a gift from Feng Zhang (Addgene plasmid # 62884 ; http://n2t.net/addgene:62884 ; RRID:Addgene_62884)
  • For your References section:

    A split-Cas9 architecture for inducible genome editing and transcription modulation. Zetsche B, Volz SE, Zhang F. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149. 10.1038/nbt.3149 PubMed 25643054