Skip to main content

pRPR1(1xTetO)_gRNA_handle_RPR1t
(Plasmid #62966)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62966 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRS425
  • Backbone size (bp) 7700
  • Vector type
    Yeast Expression
  • Promoter RPR1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer AATACGCAAACCGCCTCTCC
  • 3′ sequencing primer TGTGCTGCAAGGCGATTAAGTTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRPR1(1xTetO)_gRNA_handle_RPR1t was a gift from Timothy Lu (Addgene plasmid # 62966 ; http://n2t.net/addgene:62966 ; RRID:Addgene_62966)
  • For your References section:

    Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. Farzadfard F, Perli SD, Lu TK. ACS Synth Biol. 2013 Sep 11. 10.1021/sb400081r PubMed 23977949