-
Purpose(Empty Backbone) Destination vector for Gateway based on vector #395 from the Tol2Kit, containing a gRNA scaffold under the control of a zebrafish U6 promoter, and cmlc2:GFP as a transgenesis marker.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63156 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDestTol2CG2 (Tol2Kit#395)
- Backbone size (bp) 8267
-
Modifications to backboneMutated the BseRI site present in GFP. Added a zebrafish U6 promoter driving a gRNA scaffold containing BseRI sites to clone the seed.
-
Vector typeCRISPR ; Tol2 destination vector for Gateway
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsMay need to grow for 2 days in liquid media to achieve turbid culture
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GAGGATCATAATCAGCCATA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Reference for the Tol2Kit:
Kwan, K.M., Fujimoto, E., Grabher, C., Mangum, B.D., Hardy, M.E., Campbell, D.S., Parant, J.M., Yost, H.J., Kanki, J.P., and Chien, C.B. (2007). The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Dev Dyn 236, 3088-3099.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDestTol2CG2-U6:gRNA was a gift from Leonard Zon (Addgene plasmid # 63156 ; http://n2t.net/addgene:63156 ; RRID:Addgene_63156) -
For your References section:
A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish. Ablain J, Durand EM, Yang S, Zhou Y, Zon LI. Dev Cell. 2015 Mar 4. pii: S1534-5807(15)00075-1. doi: 10.1016/j.devcel.2015.01.032. 10.1016/j.devcel.2015.01.032 PubMed 25752963