Skip to main content

phage ubc nls ha pcp gfp
(Plasmid #64539)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64539 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHAGE-UbiC
  • Total vector size (bp) 7385
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PCP
  • Alt name
    PP7 coat protein
  • Species
    bacteriophage
  • Promoter human ubiquitin C promoter
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • HA (N terminal on insert)
    • FactorXa site (N terminal on insert)
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer hUBCpro-F2 CGCCGATGATTATATAAGGA
  • 3′ sequencing primer EGFP-N
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    phage ubc nls ha pcp gfp was a gift from Jeffrey Chao (Addgene plasmid # 64539 ; http://n2t.net/addgene:64539 ; RRID:Addgene_64539)
  • For your References section:

    Translation. An RNA biosensor for imaging the first round of translation from single cells to living animals. Halstead JM, Lionnet T, Wilbertz JH, Wippich F, Ephrussi A, Singer RH, Chao JA. Science. 2015 Mar 20;347(6228):1367-671. doi: 10.1126/science.aaa3380. 10.1126/science.aaa3380 PubMed 25792328