-
PurposeUsed to label reporter mRNAs. Lentiviral expression of the MCP protein fused to tagRFP.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64541 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHAGE-UbiC
- Total vector size (bp) 7787
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMCP
-
Alt name2x MS2 coat protein
- Promoter human ubiquitin C promoter
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- HA (N terminal on insert)
- tagRFP-T (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer hUBCpro-F2 CGCCGATGATTATATAAGGA
- 3′ sequencing primer mTagBFP-R
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
phage UBC NLS-HA-2XMCP-tagRFPt was a gift from Jeffrey Chao (Addgene plasmid # 64541 ; http://n2t.net/addgene:64541 ; RRID:Addgene_64541) -
For your References section:
Translation. An RNA biosensor for imaging the first round of translation from single cells to living animals. Halstead JM, Lionnet T, Wilbertz JH, Wippich F, Ephrussi A, Singer RH, Chao JA. Science. 2015 Mar 20;347(6228):1367-671. doi: 10.1126/science.aaa3380. 10.1126/science.aaa3380 PubMed 25792328