-
PurposeTRICK translation biosensor with 12x copies of modified PP7 stem loops and 24x MS2 stem loops.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64542 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmaxGFP
-
Backbone manufacturerLonza
- Total vector size (bp) 7175
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name12x PP7 stem-loops
-
SpeciesSynthetic
- Promoter ponA
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- HA (N terminal on insert)
- dNP799 (N terminal on insert)
- 24xMS2 stem loops (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pCasper-hs GCAACTACTGAAATCTGCCAAG
- 3′ sequencing primer EBV-rev
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Translatable PP7 stem-loops were generated by gene synthesis (Genscript) removing potential stop codons in all three reading frames. The 405 nucleotide stem-loop cassette contained six copies of the PP7 stem-loops and were optimally positioned 40 nucleotides apart to prevent ribosomes stalling at adjacent stem-loops. The PP7 stem-loops were also codon optimized (tRNA abundance and coding potential) and RNA-folding (mfold). The 6x PP7stem-loop cassette was multimerized using SalI and XhoI to generate a cassette with 12 copies of the PP7 stem-loops.
The PP7 stem-loop cassette cloned into a modified version of the pmaxGFP plasmid (Lonza), which contains the CMV immediate early promoter for expression and the β-globin-IgG chimeric intron in the 5′ UTR. The GFP sequence was replaced by NLS-3xHA tagged dNP799 (a fluoregen activating protein). The PP7 stem-loop cassette was fused in-frame to the C-terminus of dNP799. The 24x MS2 stem-loop cassette was cloned downstream of the stop codon of the pp7 stem-loop cassette.
The CMV promoter was replaced by 45 copies of the E/GRE recognition elements (ponA-45) to induce expression of the reporter mRNA in the presence of ponasterone A. The E/GRE elements are bound by a heterodimer of retinoid-X-receptor (RXR) and a synthetic ecodysone receptor (VgEcR).
The final construct contains the following features: ponA-45 - chimeric intron – NLS - 3xHA – dNP799 – 12x PP7 stem-loops – stop codon – 24x MS2 stem-loops – SV40 polyA. See publication for more details.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmax pona 12xTRICK 24xMS2SL was a gift from Jeffrey Chao (Addgene plasmid # 64542 ; http://n2t.net/addgene:64542 ; RRID:Addgene_64542) -
For your References section:
Translation. An RNA biosensor for imaging the first round of translation from single cells to living animals. Halstead JM, Lionnet T, Wilbertz JH, Wippich F, Ephrussi A, Singer RH, Chao JA. Science. 2015 Mar 20;347(6228):1367-671. doi: 10.1126/science.aaa3380. 10.1126/science.aaa3380 PubMed 25792328