-
PurposeRetroviral introduction of Cas9 into mammalian cell line.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65655 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMSCV_puro
-
Backbone manufacturerclontech
- Backbone size w/o insert (bp) 6200
- Total vector size (bp) 10475
-
Vector typeMammalian Expression, Retroviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
Alt nameS. pyogenes CRISPR-Cas9
-
SpeciesSynthetic
-
Insert Size (bp)4200
- Promoter MSSV_LTR
-
Tag
/ Fusion Protein
- 5 ' FLAG tag
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bythe human Cas9 coding sequence is PCR cloned from lentiCRISPR-Cas9 plasmid (Addgene: # 49535)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV_Cas9_puro was a gift from Christopher Vakoc (Addgene plasmid # 65655 ; http://n2t.net/addgene:65655 ; RRID:Addgene_65655) -
For your References section:
Discovery of cancer drug targets by CRISPR-Cas9 screening of protein domains. Shi J, Wang E, Milazzo JP, Wang Z, Kinney JB, Vakoc CR. Nat Biotechnol. 2015 May 11. doi: 10.1038/nbt.3235. 10.1038/nbt.3235 PubMed 25961408