-
Purpose(Empty Backbone) Lentiviral introduction of sgRNA constitute expression linked with GFP marker into mammalian cell line.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65656 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLenti virus
-
Backbone manufacturerModified from lentiCRISPRv1 (Addgene Plasmid 49535)
- Backbone size (bp) 9294
-
Vector typeMammalian Expression, Lentiviral, CRISPR
- Promoter U6 promoter-driven sgRNA expression and EFS promoter-driven GFP expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AACCGGTGCCTAGAGAAGGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe U6-sgRNA-EFS-GFP vector was derived from the lentiCRISPR-Cas9 plasmid (Addgene: # 49535) by removing the hCas9 cDNA and replacing the Puro cassette with GFP reporter.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LRG (Lenti_sgRNA_EFS_GFP) was a gift from Christopher Vakoc (Addgene plasmid # 65656 ; http://n2t.net/addgene:65656 ; RRID:Addgene_65656) -
For your References section:
Discovery of cancer drug targets by CRISPR-Cas9 screening of protein domains. Shi J, Wang E, Milazzo JP, Wang Z, Kinney JB, Vakoc CR. Nat Biotechnol. 2015 May 11. doi: 10.1038/nbt.3235. 10.1038/nbt.3235 PubMed 25961408