pYNL-C1_Rab11a
(Plasmid
#65705)
-
PurposeExpresses YNL-Rab11a in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65705 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepYNL-C1
-
Backbone manufacturerAddgene #64306
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 6300
-
Vector typeMammalian Expression, Luciferase
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab11a
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)650
- Promoter CMV
-
Tag
/ Fusion Protein
- YNL (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GAGTTCGTGAAGGTGAAGGGCC
- 3′ sequencing primer EBV Reverse (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byNano-lantern/pcDNA3 (gifted from Dr Takeharu Nagai)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYNL-C1_Rab11a was a gift from Yasushi Okada (Addgene plasmid # 65705 ; http://n2t.net/addgene:65705 ; RRID:Addgene_65705) -
For your References section:
Expanded palette of Nano-lanterns for real-time multicolor luminescence imaging. Takai A, Nakano M, Saito K, Haruno R, Watanabe TM, Ohyanagi T, Jin T, Okada Y, Nagai T. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):4352-6. doi: 10.1073/pnas.1418468112. Epub 2015 Mar 23. 10.1073/pnas.1418468112 PubMed 25831507