Skip to main content

pLV hUbC- VP64-dCas9-VP64-T2A- GFP(No LoxP sites)
(Plasmid #66708)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 66708 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FUGW
  • Total vector size (bp) 15000
  • Vector type
    Lentiviral, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    S.Pyogenes VP64-dCas9-VP64
  • Species
    S.Pyogenes
  • Mutation
    D10A and H840A
  • Promoter hUbC
  • Tag / Fusion Protein
    • VP64

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCGGGTTTATTACAGGGACAGCAG
  • 3′ sequencing primer TGACAACGGGCCACAACTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV hUbC- VP64-dCas9-VP64-T2A- GFP(No LoxP sites) was a gift from Charles Gersbach (Addgene plasmid # 66708 ; http://n2t.net/addgene:66708 ; RRID:Addgene_66708)