pAAV-cFos-tTA-pA
(Plasmid #66794)

• Purpose: Expresses TetActivator protein under the control of the c-fos promoter for use in TetTaging
• Depositing Lab: William Wisden
• Publication: Zhang et al Nat Neurosci. 2015 Apr;18(4):553-61. doi: 10.1038/nn.3957. Epub 2015 Feb 23.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
• How this works:
  • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pUC
• Backbone size w/o insert (bp): 3600
• Total vector size (bp): 6673
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: cfos promoter linked to the tet activator gene
• Species: Synthetic
• Insert Size (bp): 1945
• Tag / Fusion Protein:
  • no

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: GACCATCTCCGAAATCCTACACG
• 3′ sequencing primer: ACAAAGGCATTAAAGCAGCGTATCCACAT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: cfos-tTA was taken from Addgene plasmid ID #: 34856
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry